Gene Expression and Chemistry Review Problem Solving .Discussion

Gene Expression and Chemistry Review Problem Solving .Discussion
July 27, 2020 Comments Off on Gene Expression and Chemistry Review Problem Solving .Discussion Uncategorized Assignment-help
Words: 207
Pages: 1
Subject: Uncategorized

Please answer the following:1. Understanding: In various biotechnology applications, double-stranded DNA is often denatured (separated) into single strands by heating to near-boiling temperatures. Looking at the two types of base pairs (Figure 3.9 in your book), would A-T-rich sequences or G-C-rich sequences denature more readily? Please explain your reasoning in 1-2 sentences.2. Applying: Given the following DNA sequence:5’CTTGCGTCACCTGAGACCTGGCATCG3’a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5′ and 3′ ends)b) Write the peptide sequence translated from the mRNA in part A.3. Understanding: Explain how splicing can allow the same gene to encode different proteins of different lengths.4. Understanding: Explain the role of each of the types of RNA below in translation, including which step(s) the mRNA is involved in and the role of base pairing in the RNA’s function.mRNAtRNArRNA5. Analyzing: Several common antibiotics affect cells’ ability to carry out the central dogma:•Rifamycin inhibits prokaryotic RNA polymerase.•Chloramphenicol blocks transfer of the peptide from P to A site.a. For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible.b.Why is it that these drugs kill bacteria but spare animal cells?